In-Place Radix Sort

Well, here's a simple implementation of an MSD radix sort for DNA. It's written in D because that's the language that I use most and therefore am least likely to make silly mistakes in, but it could easily be translated to some other language. It's in-place but requires 2 * seq.length passes through the array.

void radixSort(string[] seqs, size_t base = 0) {
    if(seqs.length == 0)
        return;

    size_t TPos = seqs.length, APos = 0;
    size_t i = 0;
    while(i < TPos) {
        if(seqs[i][base] == 'A') {
             swap(seqs[i], seqs[APos++]);
             i++;
        }
        else if(seqs[i][base] == 'T') {
            swap(seqs[i], seqs[--TPos]);
        } else i++;
    }

    i = APos;
    size_t CPos = APos;
    while(i < TPos) {
        if(seqs[i][base] == 'C') {
            swap(seqs[i], seqs[CPos++]);
        }
        i++;
    }
    if(base < seqs[0].length - 1) {
        radixSort(seqs[0..APos], base + 1);
        radixSort(seqs[APos..CPos], base + 1);
        radixSort(seqs[CPos..TPos], base + 1);
        radixSort(seqs[TPos..seqs.length], base + 1);
   }
}

Obviously, this is kind of specific to DNA, as opposed to being general, but it should be fast.

Edit:

I got curious whether this code actually works, so I tested/debugged it while waiting for my own bioinformatics code to run. The version above now is actually tested and works. For 10 million sequences of 5 bases each, it's about 3x faster than an optimized introsort.

I've never seen an in-place radix sort, and from the nature of the radix-sort I doubt that it is much faster than a out of place sort as long as the temporary array fits into memory.

Reason:

The sorting does a linear read on the input array, but all writes will be nearly random. From a certain N upwards this boils down to a cache miss per write. This cache miss is what slows down your algorithm. If it's in place or not will not change this effect.

I know that this will not answer your question directly, but if sorting is a bottleneck you may want to have a look at near sorting algorithms as a preprocessing step (the wiki-page on the soft-heap may get you started).

That could give a very nice cache locality boost. A text-book out-of-place radix sort will then perform better. The writes will still be nearly random but at least they will cluster around the same chunks of memory and as such increase the cache hit ratio.

I have no idea if it works out in practice though.

Btw: If you're dealing with DNA strings only: You can compress a char into two bits and pack your data quite a lot. This will cut down the memory requirement by factor four over a naiive representation. Addressing becomes more complex, but the ALU of your CPU has lots of time to spend during all the cache-misses anyway.

You can certainly drop the memory requirements by encoding the sequence in bits. You are looking at permutations so, for length 2, with "ACGT" that's 16 states, or 4 bits. For length 3, that's 64 states, which can be encoded in 6 bits. So it looks like 2 bits for each letter in the sequence, or about 32 bits for 16 characters like you said.

If there is a way to reduce the number of valid 'words', further compression may be possible.

So for sequences of length 3, one could create 64 buckets, maybe sized uint32, or uint64. Initialize them to zero. Iterate through your very very large list of 3 char sequences, and encode them as above. Use this as a subscript, and increment that bucket.
Repeat this until all of your sequences have been processed.

Next, regenerate your list.

Iterate through the 64 buckets in order, for the count found in that bucket, generate that many instances of the sequence represented by that bucket.
when all of the buckets have been iterated, you have your sorted array.

A sequence of 4, adds 2 bits, so there would be 256 buckets. A sequence of 5, adds 2 bits, so there would be 1024 buckets.

At some point the number of buckets will approach your limits. If you read the sequences from a file, instead of keeping them in memory, more memory would be available for buckets.

I think this would be faster than doing the sort in situ as the buckets are likely to fit within your working set.

Here is a hack that shows the technique

#include <iostream>
#include <iomanip>

#include <math.h>

using namespace std;

const int width = 3;
const int bucketCount = exp(width * log(4)) + 1;
      int *bucket = NULL;

const char charMap[4] = {'A', 'C', 'G', 'T'};

void setup
(
    void
)
{
    bucket = new int[bucketCount];
    memset(bucket, '\0', bucketCount * sizeof(bucket[0]));
}

void teardown
(
    void
)
{
    delete[] bucket;
}

void show
(
    int encoded
)
{
    int z;
    int y;
    int j;
    for (z = width - 1; z >= 0; z--)
    {
        int n = 1;
        for (y = 0; y < z; y++)
            n *= 4;

        j = encoded % n;
        encoded -= j;
        encoded /= n;
        cout << charMap[encoded];
        encoded = j;
    }

    cout << endl;
}

int main(void)
{
    // Sort this sequence
    const char *testSequence = "CAGCCCAAAGGGTTTAGACTTGGTGCGCAGCAGTTAAGATTGTTT";

    size_t testSequenceLength = strlen(testSequence);

    setup();


    // load the sequences into the buckets
    size_t z;
    for (z = 0; z < testSequenceLength; z += width)
    {
        int encoding = 0;

        size_t y;
        for (y = 0; y < width; y++)
        {
            encoding *= 4;

            switch (*(testSequence + z + y))
            {
                case 'A' : encoding += 0; break;
                case 'C' : encoding += 1; break;
                case 'G' : encoding += 2; break;
                case 'T' : encoding += 3; break;
                default  : abort();
            };
        }

        bucket[encoding]++;
    }

    /* show the sorted sequences */ 
    for (z = 0; z < bucketCount; z++)
    {
        while (bucket[z] > 0)
        {
            show(z);
            bucket[z]--;
        }
    }

    teardown();

    return 0;
}